Search Results

You searched for all publications:

with publication states 'Published (Approved)'

Search Again...

These results only include publications that have been reviewed and processed by Diamond Light Source. To also view papers that have not yet been processed click here.

You can use the folder icon under Actions to collate papers as required. You can then click on View Folder in the left-hand navigation to review and/or download your folder.

Exact matches
Related results

4 items found (0 items not approved), displaying all items.1

Instruments / Technical Area	Publication Details	Published
I02-Macromolecular Crystallography I23-Long wavelength MX	Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths Yashu Zhang , Kamel El Omari , Ramona Duman , Sisi Liu , Shozeb Haider , Armin Wagner , Gary N. Parkinson , Dengguo Wei Nucleic Acids Research 45 DOI: 10.1093/nar/gkaa439 Diamond Proposal Number(s): [12305] Open Access Show Abstract ▼ Abstract: Obtaining phase information remains a formidable challenge for nucleic acid structure determination. The introduction of an X-ray synchrotron beamline designed to be tunable to long wavelengths at Diamond Light Source has opened the possibility to native de novo structure determinations by the use of intrinsic scattering elements. This provides opportunities to overcome the limitations of introducing modifying nucleotides, often required to derive phasing information. In this paper, we build on established methods to generate new tools for nucleic acid structure determinations. We report on the use of (i) native intrinsic potassium single-wavelength anomalous dispersion methods (K-SAD), (ii) use of anomalous scattering elements integral to the crystallization buffer (extrinsic cobalt and intrinsic potassium ions), (iii) extrinsic bromine and intrinsic phosphorus SAD to solve complex nucleic acid structures. Using the reported methods we solved the structures of (i) Pseudorabies virus (PRV) RNA G-quadruplex and ligand complex, (ii) PRV DNA G-quadruplex, and (iii) an i-motif of human telomeric sequence. Our results highlight the utility of using intrinsic scattering as a pathway to solve and determine non-canonical nucleic acid motifs and reveal the variability of topology, influence of ligand binding, and glycosidic angle rearrangements seen between RNA and DNA G-quadruplexes of the same sequence.	May 2020
I24-Microfocus Macromolecular Crystallography	Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex Dengguo Wei , Alan K. Todd , Mire Zloh , Mekala Gunaratnam , Gary Parkinson , Stephen Neidle Journal Of The American Chemical Society 135 (51), 19319 - 19329 DOI: 10.1021/ja4101358 PMID: 24295054 Show Abstract ▼ Abstract: The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3′ and 5′ ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.	Dec 2013
I24-Microfocus Macromolecular Crystallography	Small-molecule binding to the DNA minor groove is mediated by a conserved water cluster Dengguo Wei , W. David Wilson , Stephen Neidle Journal Of The American Chemical Society 135 (4) DOI: 10.1021/ja308952y PMID: 23276263 Show Abstract ▼ Abstract: High-resolution crystal structures of the DNA duplex sequence d(CGCGAATTCGCG)2 complexed with three minor-groove ligands are reported. A highly conserved cluster of 11 linked water molecules has been found in the native and all 3 ligand-bound structures, positioned at the boundary of the A/T and G/C regions where the minor groove widens. This cluster appears to play a key structural role in stabilizing noncovalently binding small molecules in the AT region of the B-DNA minor groove. The cluster extends from the backbone phosphate groups along the mouth of the groove and links to DNA and ligands by a network of hydrogen bonds that help to maintain the ligands in position. This arrangement of water molecules is distinct from, but linked by, hydrogen bonding to the well-established spine of hydration, which is displaced by bound ligands. Features of the water cluster and observed differences in binding modes help to explain the measured binding affinities and thermodynamic characteristics of these ligands on binding to AT sites in DNA.	Dec 2012
I03-Macromolecular Crystallography	Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation Dengguo Wei , Gary N. Parkinson , Anthony P. Reszka , Stephen Neidle Nucleic Acids Research DOI: 10.1093/nar/gks023 PMID: 22287624 Diamond Proposal Number(s): [1222] Open Access Show Abstract ▼ Abstract: We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.	Jan 2012

Publications Database

Search Results

You searched for all publications:

Search Again...

Subject Areas (check all that apply) select all

Instruments used to collect data (check all that apply) select all

Collaborations involved (check all that apply) select all

Diamond Offline Facilities used

Relevant Technical Areas (check all that apply) select all

Menu for Anonymous User