Search Results

You searched for all publications:

with publication states 'Published (Approved)'

Search Again...

These results only include publications that have been reviewed and processed by Diamond Light Source. To also view papers that have not yet been processed click here.

You can use the folder icon under Actions to collate papers as required. You can then click on View Folder in the left-hand navigation to review and/or download your folder.

Exact matches
Related results

29 items found (0 items not approved), displaying 1 to 10.[First/Prev] 1, 2, 3 [Next/Last]

Instruments / Technical Area	Publication Details	Published
I03-Macromolecular Crystallography	Rapid escape of new SARS-CoV-2 Omicron variants from BA.2 directed antibody responses Aiste Dijokaite-Guraliuc , Raksha Das , Daming Zhou , Helen M. Ginn , Chang Liu , Helen M. E. Duyvesteyn , Jiandong Huo , Rungtiwa Nutalai , Piyada Supasa , Muneeswaran Selvaraj , Thushan I. De Silva , Megan Plowright , Thomas A. H. Newman , Hailey Hornsby , Alexander J. Mentzer , Donal Skelly , Thomas G. Ritter , Nigel Temperton , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Cornelius Roemer , Thomas P. Peacock , Neil G. Paterson , Mark A. Williams , David R. Hall , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell Reports DOI: 10.1016/j.celrep.2023.112271 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: In November 2021 Omicron BA.1, containing a raft of new spike mutations emerged and quickly spread globally. Intense selection pressure to escape the antibody response produced by vaccines or SARS-CoV-2 infection then led to a rapid succession of Omicron sub-lineages with waves of BA.2 then BA.4/5 infection. Recently, many variants have emerged such as BQ.1 and XBB, which carry up to 8 additional RBD amino-acid substitutions compared to BA.2. We describe a panel of 25 potent mAbs generated from vaccinees suffering BA.2 breakthrough infections. Epitope mapping shows potent mAb binding shifting to 3 clusters, 2 corresponding to early-pandemic binding hotspots. The RBD mutations in recent variants map close to these binding sites and knock out or severely knock down neutralization activity of all but 1 potent mAb. This recent mAb escape corresponds with large falls in neutralization titre of vaccine or BA.1, BA.2 or BA.4/5 immune serum.	Mar 2023
I03-Macromolecular Crystallography I24-Microfocus Macromolecular Crystallography	Room-temperature crystallography reveals altered binding of small-molecule fragments to PTP1B Tamar Skaist Mehlmam , Justin T. Biel , Syeda Maryam Azeem , Elliot R. Nelson , Sakib Hossain , Louise Dunnett , Neil G. Paterson , Alice Douangamath , Romain Talon , Danny Axford , Helen Orins , Frank Von Delft , Daniel A. Keedy Elife 12 DOI: 10.7554/eLife.84632 Diamond Proposal Number(s): [15751, 18340, 23570] Open Access Show Abstract ▼ Abstract: Much of our current understanding of how small-molecule ligands interact with proteins stems from X-ray crystal structures determined at cryogenic (cryo) temperature. For proteins alone, room-temperature (RT) crystallography can reveal previously hidden, biologically relevant alternate conformations. However, less is understood about how RT crystallography may impact the conformational landscapes of protein-ligand complexes. Previously, we showed that small-molecule fragments cluster in putative allosteric sites using a cryo crystallographic screen of the therapeutic target PTP1B (Keedy et al., 2018). Here, we have performed two RT crystallographic screens of PTP1B using many of the same fragments, representing the largest RT crystallographic screens of a diverse library of ligands to date, and enabling a direct interrogation of the effect of data collection temperature on protein-ligand interactions. We show that at RT, fewer ligands bind, and often more weakly – but with a variety of temperature-dependent differences, including unique binding poses, changes in solvation, new binding sites, and distinct protein allosteric conformational responses. Overall, this work suggests that the vast body of existing cryo-temperature protein-ligand structures may provide an incomplete picture, and highlights the potential of RT crystallography to help complete this picture by revealing distinct conformational modes of protein-ligand systems. Our results may inspire future use of RT crystallography to interrogate the roles of protein-ligand conformational ensembles in biological function.	Mar 2023
I03-Macromolecular Crystallography	A delicate balance between antibody evasion and ACE2 affinity for Omicron BA.2.75 Jiandong Huo , Aiste Dijokaite-Guraliuc , Chang Liu , Raksha Das , Piyada Supasa , Muneeswaran Selvaraj , Rungtiwa Nutalai , Daming Zhou , Alexander J. Mentzer , Donal Skelly , Thomas G. Ritter , Ali Amini , Sagida Bibi , Sandra Adele , Sile Ann Johnson , Neil G. Paterson , Mark A. Williams , David R. Hall , Megan Plowright , Thomas A. H. Newman , Hailey Hornsby , Thushan I. De Silva , Nigel Temperton , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Andrew J. Pollard , Teresa Lambe , Philip Goulder , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell Reports DOI: 10.1016/j.celrep.2022.111903 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: Variants of SARS CoV-2 have caused successive global waves of infection. These variants, with multiple mutations in the spike protein are thought to facilitate escape from natural and vaccine-induced immunity and often increase in the affinity for ACE2. The latest variant to cause concern is BA.2.75, identified in India where it is now the dominant strain, with evidence of wider dissemination. BA.2.75 is derived from BA.2 and contains four additional mutations in the receptor binding domain (RBD). Here we perform an antigenic and biophysical characterization of BA.2.75, revealing an interesting balance between humoral evasion and ACE2 receptor affinity. ACE2 affinity for BA.2.75 is increased 9-fold compared to BA.2; there is also evidence of escape of BA.2.75 from immune serum, particularly that induced by Delta infection which may explain the rapid spread in India, where BA.2.75 is now the dominant variant. ACE2 affinity appears to be prioritised over greater escape.	Dec 2022
I03-Macromolecular Crystallography	Antibody escape of SARS-CoV-2 Omicron BA.4 and BA.5 from vaccine and BA.1 serum Aekkachai Tuekprakhon , Jiandong Huo , Rungtiwa Nutalai , Aiste Dijokaite-Guraliuc , Daming Zhou , Helen M. Ginn , Muneeswaran Selvaraj , Chang Liu , Alexander J. Mentzer , Piyada Supasa , Helen M. E. Duyvesteyn , Raksha Das , Donal Skelly , Thomas G. Ritter , Ali Amini , Sagida Bibi , Sandra Adele , Sile Ann Johnson , Bede Constantinides , Hermione Webster , Nigel Temperton , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Derrick Crook , Andrew J. Pollard , Teresa Lambe , Philip Goulder , Neil G. Paterson , Mark A. Williams , David R. Hall , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton , Christopher Conlon , Alexandra Deeks , John Frater , Lisa Frending , Siobhan Gardiner , Anni Jämsén , Katie Jeffery , Tom Malone , Eloise Phillips , Lucy Rothwell , Lizzie Stafford Cell DOI: 10.1016/j.cell.2022.06.005 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: The Omicron lineage of SARS-CoV-2, first described in November 2021, spread rapidly to become globally dominant and has split into a number of sub-lineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa’s Gauteng region uncovered two new sub-lineages, BA.4 and BA.5 which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences and, although closely related to BA.2, contain further mutations in the receptor binding domain of spike. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by serum from triple AstraZeneca or Pfizer vaccinated individuals compared to BA.1 and BA.2. Furthermore, using serum from BA.1 vaccine breakthrough infections there are likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.	Jun 2022
I03-Macromolecular Crystallography I04-1-Macromolecular Crystallography (fixed wavelength) I04-Macromolecular Crystallography I24-Microfocus Macromolecular Crystallography	De novo design of discrete, stable 310-helix peptide assemblies Prasun Kumar , Neil G. Paterson , Jonathan Clayden , Derek N. Woolfson Nature 37 DOI: 10.1038/s41586-022-04868-x Diamond Proposal Number(s): [23269] Show Abstract ▼ Abstract: The α-helix is pre-eminent in structural biology1 and widely exploited in protein folding2, design3 and engineering4. Although other helical peptide conformations do exist near to the α-helical region of conformational space—namely, 310-helices and π-helices5—these occur much less frequently in protein structures. Less favourable internal energies and reduced tendencies to pack into higher-order structures mean that 310-helices rarely exceed six residues in length in natural proteins, and that they tend not to form normal supersecondary, tertiary or quaternary interactions. Here we show that despite their absence in nature, synthetic peptide assemblies can be built from 310-helices. We report the rational design, solution-phase characterization and an X-ray crystal structure for water-soluble bundles of 310-helices with consolidated hydrophobic cores. The design uses six-residue repeats informed by analysing 310-helical conformations in known protein structures, and incorporates α-aminoisobutyric acid residues. Design iterations reveal a tipping point between α-helical and 310-helical folding, and identify features required for stabilizing assemblies of 310-helices. This work provides principles and rules to open opportunities for designing into this hitherto unexplored region of protein-structure space.	Jun 2022
I03-Macromolecular Crystallography I04-Macromolecular Crystallography Krios I-Titan Krios I at Diamond	Potent cross-reactive antibodies following Omicron breakthrough in vaccinees Rungtiwa Nutalai , Daming Zhou , Aekkachai Tuekprakhon , Helen M. Ginn , Piyada Supasa , Chang Liu , Jiandong Huo , Alexander J. Mentzer , Helen M. E. Duyvesteyn , Aiste Dijokaite-Guraliuc , Donal Skelly , Thomas G. Ritter , Ali Amini , Sagida Bibi , Sandra Adele , Sile Ann Johnson , Bede Constantinides , Hermione Webster , Nigel Temperton , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Derrick Crook , Andrew J. Pollard , Teresa Lambe , Philip Goulder , Neil G. Paterson , Mark A. Williams , David R. Hall , Juthathip Mongkolsapaya , Elizabeth E. Fry , Wanwisa Dejnirattisai , Jingshan Ren , David I. Stuart , Gavin R. Screaton , Christopher Conlon , Alexandra Deeks , John Frater , Lisa Frending , Siobhan Gardiner , Anni Jämsén , Katie Jeffery , Tom Malone , Eloise Phillips , Lucy Rothwell , Lizzie Stafford Cell DOI: 10.1016/j.cell.2022.05.014 Diamond Proposal Number(s): [27009, 26983] Open Access Show Abstract ▼ Abstract: Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1 and BA.2. BA.2 RBD has slightly higher ACE2 affinity than BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site, however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focussed in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains and many show broad reactivity with variants of concern.	May 2022
I03-Macromolecular Crystallography	Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex Kane Mcquaid , Shuntaro Takahashi , Lena Baumgaertner , David J. Cardin , Neil G. Paterson , James P. Hall , Naoki Sugimoto , Christine J. Cardin Journal Of The American Chemical Society 75 DOI: 10.1021/jacs.2c00178 Diamond Proposal Number(s): [27314] Open Access Show Abstract ▼ Abstract: The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.	Mar 2022
I03-Macromolecular Crystallography	SARS-CoV-2 Omicron-B.1.1.529 leads to widespread escape from neutralizing antibody responses Wanwisa Dejnirattisai , Jiandong Huo , Daming Zhou , Jiří Zahradník , Piyada Supasa , Chang Liu , Helen M. E. Duyvesteyn , Helen M. Ginn , Alexander J. Mentzer , Aekkachai Tuekprakhon , Rungtiwa Nutalai , Beibei Wang , Aiste Dijokaite , Suman Khan , Ori Avinoam , Mohammad Bahar , Donal Skelly , Sandra Adele , Sile Ann Johnson , Ali Amini , Thomas Ritter , Chris Mason , Christina Dold , Daniel Pan , Sara Assadi , Adam Bellass , Nikki Omo-Dare , David Koeckerling , Amy Flaxman , Daniel Jenkin , Parvinder K. Aley , Merryn Voysey , Sue Ann Costa Clemens , Felipe Gomes Naveca , Valdinete Nascimento , Fernanda Nascimento , Cristiano Fernandes Da Costa , Paola Cristina Resende , Alex Pauvolid-Correa , Marilda M. Siqueira , Vicky Baillie , Natali Serafin , Gaurav Kwatra , Kelly Da Silva , Shabir A. Madhi , Marta C. Nunes , Tariq Malik , Peter J. M. Openshaw , J. Kenneth Baillie , Malcolm G. Semple , Alain R. Townsend , Kuan-Ying A. Huang , Tiong Kit Tan , Miles W. Carroll , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Bede Constantinides , Hermione Webster , Derrick Crook , Andrew J. Pollard , Teresa Lambe , Neil G. Paterson , Mark A. Williams , David R. Hall , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , Gideon Schreiber , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.12.046 Diamond Proposal Number(s): [27009] Show Abstract ▼ Abstract: On the 24th November 2021 the sequence of a new SARS CoV-2 viral isolate Omicron-B.1.1.529 was announced, containing far more mutations in Spike (S) than previously reported variants. Neutralization titres of Omicron by sera from vaccinees and convalescent subjects infected with early pandemic as well as Alpha, Beta, Gamma, Delta are substantially reduced or fail to neutralize. Titres against Omicron are boosted by third vaccine doses and are high in cases both vaccinated and infected by Delta. Mutations in Omicron knock out or substantially reduce neutralization by most of a large panel of potent monoclonal antibodies and antibodies under commercial development. Omicron S has structural changes from earlier viruses, combining mutations conferring tight binding to ACE2 to unleash evolution driven by immune escape, leading to a large number of mutations in the ACE2 binding site which rebalance receptor affinity to that of early pandemic viruses.	Jan 2022
I03-Macromolecular Crystallography	The antibody response to SARS-CoV-2 Beta underscores the antigenic distance to other variants Chang Liu , Daming Zhou , Rungtiwa Nutalai , Helen M. E. Duyvesteyn , Aekkachai Tuekprakhon , Helen M. Ginn , Wanwisa Dejnirattisai , Piyada Supasa , Alexander J. Mentzer , Beibei Wang , James Brett Case , Yuguang Zhao , Donal T. Skelly , Rita E. Chen , Sile Ann Johnson , Thomas G. Ritter , Chris Mason , Tariq Malik , Nigel Temperton , Neil G. Paterson , Mark A. Williams , David R. Hall , Daniel K. Clare , Andrew Howe , Philip J. R. Goulder , Elizabeth E. Fry , Michael S. Diamond , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell Host & Microbe DOI: 10.1016/j.chom.2021.11.013 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: Alpha-B.1.1.7, Beta-B.1.351, Gamma-P.1 and Delta-B.1.617.2 variants of SARS-CoV-2 express multiple mutations in the spike protein (S). These may alter the antigenic structure of S, causing escape from natural or vaccine-induced immunity. Beta is particularly difficult to neutralize using serum induced by early pandemic SARS-CoV-2 strains and is most antigenically separated from Delta. To understand this, we generated 674 mAbs from Beta infected individuals and performed a detailed structure-function analysis of the 27 most potent mAbs: one binding the spike N-terminal domain (NTD), the rest the receptor binding domain (RBD). Two of these RBD-binding mAbs recognise a neutralizing epitope conserved between SARS-CoV-1 and -2, whilst 18 target mutated residues in Beta: K417N, E484K, and N501Y. There is a major response to N501Y including a public IgVH4-39 sequence, with E484K and K417N also targeted. Recognition of these key residues underscores why serum from Beta cases poorly neutralizes early pandemic and Delta viruses.	Nov 2021
I03-Macromolecular Crystallography I04-1-Macromolecular Crystallography (fixed wavelength) I04-Macromolecular Crystallography	High-throughput crystallography reveals boron-containing inhibitors of a penicillin-binding protein with di- and tricovalent binding modes Hector Newman , Alen Krajnc , Domenico Bellini , Charles J. Eyermann , Grant A. Boyle , Neil Paterson , Katherine E. Mcauley , Robert Lesniak , Mukesh Gangar , Frank Von Delft , Jurgen Brem , Kelly Chibale , Christopher J. Schofield , Christopher G. Dowson Journal Of Medicinal Chemistry 64 DOI: 10.1021/acs.jmedchem.1c00717 Diamond Proposal Number(s): [17884] Open Access Show Abstract ▼ Abstract: The effectiveness of β-lactam antibiotics is increasingly compromised by β-lactamases. Boron-containing inhibitors are potent serine-β-lactamase inhibitors, but the interactions of boron-based compounds with the penicillin-binding protein (PBP) β-lactam targets have not been extensively studied. We used high-throughput X-ray crystallography to explore reactions of a boron-containing fragment set with the Pseudomonas aeruginosa PBP3 (PaPBP3). Multiple crystal structures reveal that boronic acids react with PBPs to give tricovalently linked complexes bonded to Ser294, Ser349, and Lys484 of PaPBP3; benzoxaboroles react with PaPBP3 via reaction with two nucleophilic serines (Ser294 and Ser349) to give dicovalently linked complexes; and vaborbactam reacts to give a monocovalently linked complex. Modifications of the benzoxaborole scaffold resulted in a moderately potent inhibition of PaPBP3, though no antibacterial activity was observed. Overall, the results further evidence the potential for the development of new classes of boron-based antibiotics, which are not compromised by β-lactamase-driven resistance.	Jul 2021

Publications Database

Search Results

You searched for all publications:

Search Again...

Subject Areas (check all that apply) select all

Instruments used to collect data (check all that apply) select all

Collaborations involved (check all that apply) select all

Diamond Offline Facilities used

Relevant Technical Areas (check all that apply) select all

Menu for Anonymous User