Search Results

You searched for all publications:

with publication states 'Published (Approved)'

Search Again...

These results only include publications that have been reviewed and processed by Diamond Light Source. To also view papers that have not yet been processed click here.

You can use the folder icon under Actions to collate papers as required. You can then click on View Folder in the left-hand navigation to review and/or download your folder.

Exact matches
Related results

23 items found (0 items not approved), displaying 1 to 10.[First/Prev] 1, 2, 3 [Next/Last]

Instruments / Technical Area	Publication Details	Published
I03-Macromolecular Crystallography	Ruthenium polypyridyl complex bound to a unimolecular chair-form G-quadruplex Kane Mcquaid , Shuntaro Takahashi , Lena Baumgaertner , David J. Cardin , Neil G. Paterson , James P. Hall , Naoki Sugimoto , Christine J. Cardin Journal Of The American Chemical Society 75 DOI: 10.1021/jacs.2c00178 Diamond Proposal Number(s): [27314] Open Access Show Abstract ▼ Abstract: The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.	Mar 2022
I03-Macromolecular Crystallography	SARS-CoV-2 Omicron-B.1.1.529 leads to widespread escape from neutralizing antibody responses Wanwisa Dejnirattisai , Jiandong Huo , Daming Zhou , Jiří Zahradník , Piyada Supasa , Chang Liu , Helen M. E. Duyvesteyn , Helen M. Ginn , Alexander J. Mentzer , Aekkachai Tuekprakhon , Rungtiwa Nutalai , Beibei Wang , Aiste Dijokaite , Suman Khan , Ori Avinoam , Mohammad Bahar , Donal Skelly , Sandra Adele , Sile Ann Johnson , Ali Amini , Thomas Ritter , Chris Mason , Christina Dold , Daniel Pan , Sara Assadi , Adam Bellass , Nikki Omo-Dare , David Koeckerling , Amy Flaxman , Daniel Jenkin , Parvinder K. Aley , Merryn Voysey , Sue Ann Costa Clemens , Felipe Gomes Naveca , Valdinete Nascimento , Fernanda Nascimento , Cristiano Fernandes Da Costa , Paola Cristina Resende , Alex Pauvolid-Correa , Marilda M. Siqueira , Vicky Baillie , Natali Serafin , Gaurav Kwatra , Kelly Da Silva , Shabir A. Madhi , Marta C. Nunes , Tariq Malik , Peter J. M. Openshaw , J. Kenneth Baillie , Malcolm G. Semple , Alain R. Townsend , Kuan-Ying A. Huang , Tiong Kit Tan , Miles W. Carroll , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Bede Constantinides , Hermione Webster , Derrick Crook , Andrew J. Pollard , Teresa Lambe , Neil G. Paterson , Mark A. Williams , David R. Hall , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , Gideon Schreiber , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.12.046 Diamond Proposal Number(s): [27009] Show Abstract ▼ Abstract: On the 24th November 2021 the sequence of a new SARS CoV-2 viral isolate Omicron-B.1.1.529 was announced, containing far more mutations in Spike (S) than previously reported variants. Neutralization titres of Omicron by sera from vaccinees and convalescent subjects infected with early pandemic as well as Alpha, Beta, Gamma, Delta are substantially reduced or fail to neutralize. Titres against Omicron are boosted by third vaccine doses and are high in cases both vaccinated and infected by Delta. Mutations in Omicron knock out or substantially reduce neutralization by most of a large panel of potent monoclonal antibodies and antibodies under commercial development. Omicron S has structural changes from earlier viruses, combining mutations conferring tight binding to ACE2 to unleash evolution driven by immune escape, leading to a large number of mutations in the ACE2 binding site which rebalance receptor affinity to that of early pandemic viruses.	Jan 2022
I03-Macromolecular Crystallography	The antibody response to SARS-CoV-2 Beta underscores the antigenic distance to other variants Chang Liu , Daming Zhou , Rungtiwa Nutalai , Helen M. E. Duyvesteyn , Aekkachai Tuekprakhon , Helen M. Ginn , Wanwisa Dejnirattisai , Piyada Supasa , Alexander J. Mentzer , Beibei Wang , James Brett Case , Yuguang Zhao , Donal T. Skelly , Rita E. Chen , Sile Ann Johnson , Thomas G. Ritter , Chris Mason , Tariq Malik , Nigel Temperton , Neil G. Paterson , Mark A. Williams , David R. Hall , Daniel K. Clare , Andrew Howe , Philip J. R. Goulder , Elizabeth E. Fry , Michael S. Diamond , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell Host & Microbe DOI: 10.1016/j.chom.2021.11.013 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: Alpha-B.1.1.7, Beta-B.1.351, Gamma-P.1 and Delta-B.1.617.2 variants of SARS-CoV-2 express multiple mutations in the spike protein (S). These may alter the antigenic structure of S, causing escape from natural or vaccine-induced immunity. Beta is particularly difficult to neutralize using serum induced by early pandemic SARS-CoV-2 strains and is most antigenically separated from Delta. To understand this, we generated 674 mAbs from Beta infected individuals and performed a detailed structure-function analysis of the 27 most potent mAbs: one binding the spike N-terminal domain (NTD), the rest the receptor binding domain (RBD). Two of these RBD-binding mAbs recognise a neutralizing epitope conserved between SARS-CoV-1 and -2, whilst 18 target mutated residues in Beta: K417N, E484K, and N501Y. There is a major response to N501Y including a public IgVH4-39 sequence, with E484K and K417N also targeted. Recognition of these key residues underscores why serum from Beta cases poorly neutralizes early pandemic and Delta viruses.	Nov 2021
I03-Macromolecular Crystallography I04-1-Macromolecular Crystallography (fixed wavelength) I04-Macromolecular Crystallography	High-throughput crystallography reveals boron-containing inhibitors of a penicillin-binding protein with di- and tricovalent binding modes Hector Newman , Alen Krajnc , Domenico Bellini , Charles J. Eyermann , Grant A. Boyle , Neil Paterson , Katherine E. Mcauley , Robert Lesniak , Mukesh Gangar , Frank Von Delft , Jurgen Brem , Kelly Chibale , Christopher J. Schofield , Christopher G. Dowson Journal Of Medicinal Chemistry 64 DOI: 10.1021/acs.jmedchem.1c00717 Diamond Proposal Number(s): [17884] Open Access Show Abstract ▼ Abstract: The effectiveness of β-lactam antibiotics is increasingly compromised by β-lactamases. Boron-containing inhibitors are potent serine-β-lactamase inhibitors, but the interactions of boron-based compounds with the penicillin-binding protein (PBP) β-lactam targets have not been extensively studied. We used high-throughput X-ray crystallography to explore reactions of a boron-containing fragment set with the Pseudomonas aeruginosa PBP3 (PaPBP3). Multiple crystal structures reveal that boronic acids react with PBPs to give tricovalently linked complexes bonded to Ser294, Ser349, and Lys484 of PaPBP3; benzoxaboroles react with PaPBP3 via reaction with two nucleophilic serines (Ser294 and Ser349) to give dicovalently linked complexes; and vaborbactam reacts to give a monocovalently linked complex. Modifications of the benzoxaborole scaffold resulted in a moderately potent inhibition of PaPBP3, though no antibacterial activity was observed. Overall, the results further evidence the potential for the development of new classes of boron-based antibiotics, which are not compromised by β-lactamase-driven resistance.	Jul 2021
I03-Macromolecular Crystallography	Reduced neutralization of SARS-CoV-2 B.1.617 by vaccine and convalescent serum Chang Liu , Helen M. Ginn , Wanwisa Dejnirattisai , Piyada Supasa , Beibei Wang , Aekkachai Tuekprakhon , Rungtiwa Nutalai , Daming Zhou , Alexander J. Mentzer , Yuguang Zhao , Helen M. E. Duyvesteyn , César López-Camacho , Jose Slon-Campos , Thomas Walter , Donal Skelly , Sile Ann Johnson , Thomas G. Ritter , Chris Mason , Sue Ann Costa Clemens , Felipe Gomes Naveca , Valdinete Nascimento , Fernanda Nascimento , Cristiano Fernandes Da Costa , Paola Cristina Resende , Alex Pauvolid-Correa , Marilda M. Siqueira , Christina Dold , Nigel Temperton , Tao Dong , Andrew J. Pollard , Julian C. Knight , Derrick Crook , Teresa Lambe , Elizabeth Clutterbuck , Sagida Bibi , Amy Flaxman , Mustapha Bittaye , Sandra Belij-Rammerstorfer , Sarah C. Gilbert , Tariq Malik , Miles W. Carroll , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Vicky Baillie , Natali Serafin , Zanele Ditse , Kelly Da Silva , Neil G. Paterson , Mark A. Williams , David R. Hall , Shabir Madhi , Marta C. Nunes , Philip Goulder , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.06.020 Diamond Proposal Number(s): [27009] Show Abstract ▼ Abstract: SARS-CoV-2 has undergone progressive change with variants conferring advantage rapidly becoming dominant lineages e.g. B.1.617. With apparent increased transmissibility variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the UK. Here we study the ability of monoclonal antibodies, convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2 and complement this with structural analyses of Fab/RBD complexes and map the antigenic space of current variants. Neutralization of both viruses is reduced when compared with ancestral Wuhan related strains but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2 suggesting that individuals previously infected by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insight for immunisation policy with future variant vaccines in non-immune populations.	Jun 2021
I03-Macromolecular Crystallography	Antibody evasion by the P.1 strain of SARS-CoV-2 Wanwisa Dejnirattisai , Daming Zhou , Piyada Supasa , Chang Liu , Alexander J. Mentzer , Helen M. Ginn , Yuguang Zhao , Helen M. E. Duyvesteyn , Aekkachai Tuekprakhon , Rungtiwa Nutalai , Beibei Wang , Guido Paesen , César López-Camacho , Jose Slon-Campos , Thomas S. Walter , Donal Skelly , Sue Ann Costa Clemens , Felipe Gomes Naveca , Valdinete Nascimento , Fernanda Nascimento , Cristiano Fernandes Da Costa , Paola C. Resende , Alex Pauvolid-Correa , Marilda M. Siqueira , Christina Dold , Robert Levin , Tao Dong , Andrew J. Pollard , Julian C. Knight , Derrick Crook , Teresa Lambe , Elizabeth Clutterbuck , Sagida Bibi , Amy Flaxman , Mustapha Bittaye , Sandra Belij-Rammerstorfer , Sarah Gilbert , Miles W. Carroll , Paul Klenerman , Eleanor Barnes , Susanna J. Dunachie , Neil G. Paterson , Mark A. Williams , David R. Hall , Ruben J. G. Hulswit , Thomas A. Bowden , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.03.055 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: Terminating the SARS-CoV-2 pandemic relies upon pan-global vaccination. Current vaccines elicit neutralizing antibody responses to the virus spike derived from early isolates. However, new strains have emerged with multiple mutations: P.1 from Brazil, B.1.351 from South Africa and B.1.1.7 from the UK (12, 10 and 9 changes in the spike respectively). All have mutations in the ACE2 binding site with P.1 and B.1.351 having a virtually identical triplet: E484K, K417N/T and N501Y, which we show confer similar increased affinity for ACE2. We show that, surprisingly, P.1 is significantly less resistant to naturally acquired or vaccine induced antibody responses than B.1.351 suggesting that changes outside the RBD impact neutralisation. Monoclonal antibody 222 neutralises all three variants despite interacting with two of the ACE2 binding site mutations, we explain this through structural analysis and use the 222 light chain to largely restore neutralization potency to a major class of public antibodies.	Mar 2021
I03-Macromolecular Crystallography	Reduced neutralization of SARS-CoV-2 B.1.1.7 variant by convalescent and vaccine sera Piyada Supasa , Daming Zhou , Wanwisa Dejnirattisai , Chang Liu , Alexander J. Mentzer , Helen M. Ginn , Yuguang Zhao , Helen M. E. Duyvesteyn , Rungtiwa Nutalai , Aekkachai Tuekprakhon , Beibei Wang , Guido Paesen , Jose Slon-Campos , César López-Camacho , Bassam Hallis , Naomi Coombes , Kevin Bewley , Sue Charlton , Thomas S. Walter , Eleanor Barnes , Susanna J. Dunachie , Donal Skelly , Sheila F. Lumley , Natalie Baker , Imam Shaik , Holly Humphries , Kerry Godwin , Nick Gent , Alex Sienkiewicz , Christina Dold , Robert Levin , Tao Dong , Andrew J. Pollard , Julian C. Knight , Paul Klenerman , Derrick Crook , Teresa Lambe , Elizabeth Clutterbuck , Sagida Bibi , Amy Flaxman , Mustapha Bittaye , Sandra Belij-Rammerstorfer , Sarah Gilbert , David R. Hall , Mark Williams , Neil G. Paterson , William James , Miles W. Carroll , Elizabeth E. Fry , Juthathip Mongkolsapaya , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.02.033 Diamond Proposal Number(s): [27009] Open Access Show Abstract ▼ Abstract: SARS-CoV-2 has caused over 2M deaths in little over a year. Vaccines are being deployed at scale, aiming to generate responses against the virus spike. The scale of the pandemic and error-prone virus replication is leading to the appearance of mutant viruses and potentially escape from antibody responses. Variant B.1.1.7, now dominant in the UK, with increased transmission, harbours 9 amino-acid changes in the spike, including N501Y in the ACE2 interacting-surface. We examine the ability of B.1.1.7 to evade antibody responses elicited by natural SARS-CoV-2 infection or vaccination. We map the impact of N501Y by structure/function analysis of a large panel of well-characterised monoclonal antibodies. B.1.1.7 is harder to neutralize than parental virus, compromising neutralization by some members of a major class of public antibodies through light chain contacts with residue 501. However, widespread escape from monoclonal antibodies or antibody responses generated by natural infection or vaccination was not observed.	Feb 2021
I03-Macromolecular Crystallography Krios I-Titan Krios I at Diamond	The antigenic anatomy of SARS-CoV-2 receptor binding domain Wanwisa Dejnirattisai , Daming Zhou , Helen M. Ginn , Helen M. E. Duyvesteyn , Piyada Supasa , James Brett Case , Yuguang Zhao , Thomas Walter , Alexander J. Mentzer , Chang Liu , Beibei Wang , Guido C. Paesen , Jose Slon-Campos , César López-Camacho , Natasha M. Kafai , Adam L. Bailey , Rita E. Chen , Baoling Ying , Craig Thompson , Jai Bolton , Alex Fyfe , Sunetra Gupta , Tiong Kit Tan , Javier Gilbert-Jaramillo , William James , Michael Knight , Miles W. Carroll , Donal Skelly , Christina Dold , Yanchun Peng , Robert Levin , Tao Dong , Andrew J. Pollard , Julian C. Knight , Paul Klenerman , Nigel Temperton , David R. Hall , Mark A. Williams , Neil G. Paterson , Felicity Bertram , C. Alistair Siebert , Daniel K. Clare , Andrew Howe , Julika Radecke , Yun Song , Alain R. Townsend , Kuan-Ying A. Huang , Elizabeth E. Fry , Juthathip Mongkolsapaya , Michael S. Diamond , Jingshan Ren , David I. Stuart , Gavin R. Screaton Cell DOI: 10.1016/j.cell.2021.02.032 Diamond Proposal Number(s): [27009, 26983] Open Access Show Abstract ▼ Abstract: Antibodies are crucial to immune protection against SARS-CoV-2, with some in emergency use as therapeutics. Here we identify 377 human monoclonal antibodies (mAbs) recognizing the virus spike, and focus mainly on 80 that bind the receptor binding domain (RBD). We devise a competition data driven method to map RBD binding sites. We find that although antibody binding sites are widely dispersed, neutralizing antibody binding is focused, with nearly all highly inhibitory mAbs (IC50<0.1μg/ml) blocking receptor interaction, except for one that binds a unique epitope in the N-terminal domain. Many of these neutralizing mAbs use public V-genes and are close to germline. We dissect the structural basis of recognition for this large panel of antibodies through X-ray crystallography and cryo-electron microscopy of 19 Fab-antigen structures. We find novel binding modes for some potently inhibitory antibodies and demonstrate that strongly neutralizing mAbs protect, prophylactically or therapeutically, in animal models.	Feb 2021
I03-Macromolecular Crystallography Krios I-Titan Krios I at Diamond	Structural basis for the neutralization of SARS-CoV-2 by an antibody from a convalescent patient Daming Zhou , Helen M. E. Duyvesteyn , Cheng-Pin Chen , Chung-Guei Huang , Ting-Hua Chen , Shin-Ru Shih , Yi-Chun Lin , Chien-Yu Cheng , Shu-Hsing Cheng , Yhu-Chering Huang , Tzou-Yien Lin , Che Ma , Jiandong Huo , Loic Carrique , Tomas Malinauskas , Reinis R. Ruza , Pranav Shah , Tiong Kit Tan , Pramila Rijal , Robert F. Donat , Kerry Godwin , Karen R. Buttigieg , Julia A. Tree , Julika Radecke , Neil Paterson , Piyada Supasa , Juthathip Mongkolsapaya , Gavin R. Screaton , Miles W. Carroll , Javier Gilbert-Jaramillo , Michael L. Knight , William James , Raymond J. Owens , James H. Naismith , Alain R. Townsend , Elizabeth E. Fry , Yuguang Zhao , Jingshan Ren , David I. Stuart , Kuan-Ying A. Huang Nature Structural & Molecular Biology 20 DOI: 10.1038/s41594-020-0480-y Diamond Proposal Number(s): [19946, 26983] Show Abstract ▼ Abstract: The COVID-19 pandemic has had an unprecedented health and economic impact and there are currently no approved therapies. We have isolated an antibody, EY6A, from an individual convalescing from COVID-19 and have shown that it neutralizes SARS-CoV-2 and cross-reacts with SARS-CoV-1. EY6A Fab binds the receptor binding domain (RBD) of the viral spike glycoprotein tightly (KD of 2 nM), and a 2.6-Å-resolution crystal structure of an RBD–EY6A Fab complex identifies the highly conserved epitope, away from the ACE2 receptor binding site. Residues within this footprint are key to stabilizing the pre-fusion spike. Cryo-EM analyses of the pre-fusion spike incubated with EY6A Fab reveal a complex of the intact spike trimer with three Fabs bound and two further multimeric forms comprising the destabilized spike attached to Fab. EY6A binds what is probably a major neutralizing epitope, making it a candidate therapeutic for COVID-19.	Jul 2020
I03-Macromolecular Crystallography Krios I-Titan Krios I at Diamond	Neutralisation of SARS-CoV-2 by destruction of the prefusion Spike Jiandong Huo , Yuguang Zhao , Jingshan Ren , Daming Zhou , Helen M. E. Duyvesteyn , Helen M. Ginn , Loic Carrique , Tomas Malinauskas , Reinis R. Ruza , Pranav N. M. Shah , Tiong Kit Tan , Pramila Rijal , Naomi Coombes , Kevin R. Bewley , Julia A. Tree , Julika Radecke , Neil Paterson , Piyasa Supasa , Juthathip Mongkolsapaya , Gavin R. Screaton , Miles Carroll , Alain Townsend , Elizabeth E. Fry , Raymond J. Owens , David I. Stuart Cell Host & Microbe DOI: 10.1016/j.chom.2020.06.010 Diamond Proposal Number(s): [19946, 26983] Open Access Show Abstract ▼ Abstract: There are as yet no licenced therapeutics for the COVID-19 pandemic. The causal coronavirus (SARS-CoV-2) binds host cells via a trimeric Spike whose receptor binding domain (RBD) recognises angiotensin-converting enzyme 2 (ACE2), initiating conformational changes that drive membrane fusion. We find that the monoclonal antibody CR3022 binds the RBD tightly, neutralising SARS-CoV-2 and report the crystal structure at 2.4 Å of the Fab/RBD complex. Some crystals are suitable for screening for entry-blocking inhibitors. The highly conserved, structure-stabilising, CR3022 epitope is inaccessible in the prefusion Spike, suggesting that CR3022 binding facilitates conversion to the fusion-incompetent post-fusion state. Cryo-EM analysis confirms that incubation of Spike with CR3022 Fab leads to destruction of the prefusion trimer. Presentation of this cryptic epitope in an RBD-based vaccine might advantageously focus immune responses. Binders at this epitope may be useful therapeutically, possibly in synergy with an antibody blocking receptor attachment.	Jun 2020

Publications Database

Search Results

You searched for all publications:

Search Again...

Subject Areas (check all that apply) select all

Instruments used to collect data (check all that apply) select all

Collaborations involved (check all that apply) select all

Diamond Offline Facilities used

Relevant Technical Areas (check all that apply) select all

Menu for Anonymous User