I03-Macromolecular Crystallography
|
Diamond Proposal Number(s):
[27314]
Open Access
Abstract: The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
|
Mar 2022
|
|
I03-Macromolecular Crystallography
|
Diamond Proposal Number(s):
[18745]
Abstract: Λ-[Ru(TAP)2(dppz)]2+ was crystallised with the G-quadruplex-forming heptamer d(TAGGGTT). Surprisingly, even though there are four unique binding sites, the complex is not in contact with any G-quartet surface. Two complexes stabilise cavities formed from terminal T·A and T·T mismatched pairs. A third shows kinking by a TAP ligand between T·T linkages, while the fourth shows sandwiching of a dppz ligand between a T·A/T·A quadruplex and a T·T mismatch, stabilised by an additional T·A base pair stacking interaction on a TAP surface. Overall, the structure shows an unexpected affinity for thymine, and suggests models for G-quadruplex loop binding.
|
Jul 2019
|
|
B23-Circular Dichroism
I02-Macromolecular Crystallography
|
Diamond Proposal Number(s):
[14493, 14916, 15733]
Abstract: Using X‐ray crystallography, we show an enantiospecificity in DNA G‐quadruplex binding, using the complexes Λ/∆‐[Ru(TAP)2(dppz‐11‐CN)]2+ (TAP=1,4,5,8‐tetraazaphenanthrene) containing the dppz (dipyridophenazine) ligand, paralleling the specificity of the complexes with duplex DNA. The Λ complex crystallises with the normally parallel stranded d(TAGGGTTA) tetraplex to give the first such antiparallel strand assembly in which syn‐guanosine is adjacent to the complex at the 5’ end of the quadruplex core. SRCD measurements confirm that the same conformational switch occurs in solution. The Δ enantiomer, by contrast, is present in the structure but stacked at the ends of the assembly. In addition, we report the structure of Λ‐[Ru(phen)2(11‐CN‐dppz)]2+ bound to d(TCGGCGCCGA), a duplex forming sequence, and use both structural models to aid in the elucidation of the motif‐specific luminescence response of the isostructural phen analogue enantiomers.
|
Apr 2019
|
|
I02-Macromolecular Crystallography
I03-Macromolecular Crystallography
|
Abstract: The new complexes [Ru(TAP)2(11‐CN‐dppz]2+ [Ru(TAP)2(11‐Br‐dppz]2+and [Ru(TAP)2(11,12‐CN2‐dppz)]2+ are reported. The addition of nitrile substituents to the dppz ligand of the DNA photooxidising complex [Ru(TAP)2(dppz)]2+ promotes π‐stacking interactions and ordered binding to DNA, as shown by X‐ray crystallography. The structure of lambda‐[Ru(TAP)2(11‐CN‐dppz)]2+ with the DNA duplex d(TCGGCGCCGA)2 shows, for the first time with this class of complex, a closed intercalation cavity with an AT base pair at the terminus. The structure obtained is compared to that formed with the 11,12‐dinitrile and 11‐Br derivatives, highlighting the stabilisation of syn guanine by this enantiomer when the terminal basepair is GC. In contrast the AT basepair has the normal Watson‐Crick orientation, highlighting the difference in charge distribution between the two purine bases and the complementarity of the dppz‐purine interaction. The asymmetry of the cavity highlights the importance of the purine‐dppz‐purine stacking interaction.
|
Jul 2018
|
|
B23-Circular Dichroism
I02-Macromolecular Crystallography
|
James Pearce
Hall
,
Sarah Prava
Gurung
,
Jessica
Henle
,
Patrick
Poidl
,
Johanna
Andersson
,
Per
Lincoln
,
Graeme
Winter
,
Thomas
Sorensen
,
David John
Cardin
,
John
Brazier
,
Christine J
Cardin
Diamond Proposal Number(s):
[9078, 7597, 15733]
Open Access
Abstract: X-ray crystal structures of three Λ-[Ru(L)2dppz]2+ complexes (L=phen, bpy) bound to d((5BrC)GGC/GCCG) show the compounds intercalated at a 5´-CG-3´ step. The compounds bind through canted intercalation, with the binding angle determined by the guanine-NH2 group, in contrast to symmetrical intercalation previously observed at 5´-TA-3´ sites. This result suggests that canted intercalation is preferred at 5´-CG-3´ sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5´-CG-3´ step could give rise to a longer luminescence lifetime than canted intercalation.
|
Jan 2017
|
|
I02-Macromolecular Crystallography
|
Diamond Proposal Number(s):
[8420]
Open Access
Abstract: [Ru(phen)2(dppz)]2+ has been studied since the 1990s due to its ‘light-switch’ properties. It can be used as a luminescent DNA probe, with emission switched on through DNA binding. The luminescence observed is dependent on the solvent accessibility of the pyrazine nitrogen atoms, and therefore is sensitive to changes in both binding site of the cation and chromophore orientation. The compound is also chiral, and there are distinct differences between the enantiomers in terms of the emission behaviour when bound to a variety of DNA sequences. Whilst a number of binary DNA-complex X-ray crystal structures are available, most include the Λ enantiomer and there is very little structural information about binding of the Δ enantiomer. Here, we present the first X-ray crystal structure of a Δ enantiomer bound to well-matched DNA, in the absence of the other, Λ enantiomer. We show how the binding site observed here can be related to a more general pattern of motifs in the crystallographic literature and propose that the Δ enantiomer can bind with five different binding modes, offering a new hypothesis for the interpretation of solution data.
|
Sep 2016
|
|
|
|
Fergus
Poynton
,
James P.
Hall
,
Paraic
Keane
,
Christine
Schwarz
,
Igor V.
Sazanovich
,
Mike
Towrie
,
Thorfinnur
Gunnlaugsson
,
Christine J
Cardin
,
David
Cardin
,
Susan J.
Quinn
,
Conor
Long
,
John
Kelly
Open Access
Abstract: The [Ru(phen)2(dppz)]2+ complex (1) is non-emissive in water but is highly luminescent in organic solvents or when bound to DNA, making it a useful probe for DNA binding. To date, a complete mechanistic explanation for this “light-switch” effect is still lacking. With this in mind we have undertaken an ultrafast time resolved infrared (TRIR) study of 1 and directly observe marker bands between 1280–1450 cm−1, which characterise both the emissive “bright” and the non-emissive “dark” excited states of the complex, in CD3CN and D2O respectively. These characteristic spectral features are present in the [Ru(dppz)3]2+ solvent light-switch complex but absent in [Ru(phen)3]2+, which is luminescent in both solvents. DFT calculations show that the vibrational modes responsible for these characteristic bands are predominantly localised on the dppz ligand. Moreover, they reveal that certain vibrational modes of the “dark” excited state couple with vibrational modes of two coordinating water molecules, and through these to the bulk solvent, thus providing a new insight into the mechanism of the light-switch effect. We also demonstrate that the marker bands for the “bright” state are observed for both Λ- and Δ-enantiomers of 1 when bound to DNA and that photo-excitation of the complex induces perturbation of the guanine and cytosine carbonyl bands. This perturbation is shown to be stronger for the Λ-enantiomer, demonstrating the different binding site properties of the two enantiomers and the ability of this technique to determine the identity and nature of the binding site of such intercalators.
|
Jan 2016
|
|
I03-Macromolecular Crystallography
I04-Macromolecular Crystallography
|
James P.
Hall
,
Fergus
Poynton
,
Paraic
Keane
,
Sarah
Gurung
,
John
Brazier
,
David
Cardin
,
Graeme
Winter
,
Thorfinnur
Gunnlaugsson
,
Igor V.
Sazanovich
,
Michael
Towrie
,
Christine J
Cardin
,
John M.
Kelly
,
Susan J.
Quinn
Abstract: To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl–DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.
|
Oct 2015
|
|
I02-Macromolecular Crystallography
|
Abstract: Polypyridyl ruthenium complexes have been
intensively studied and possess photophysical properties that
are both interesting and useful. They can act as probes for
DNA, with a substantial enhancement in emission when
bound, and can induce DNA damage upon photoirradiation.
Therefore, the synthesis and characterization of DNA binding
of new complexes is an area of intense research activity. While
knowledge of how the binding of derivatives compares to that
of the parent compound is highly desirable, this information
can be difficult to obtain. Here we report the synthesis of three
new methylated complexes, [Ru(TAP)2(dppz-10-Me)]Cl2,
[Ru(TAP)2(dppz-10,12-Me2)]Cl2, and [Ru(TAP)2(dppz-11-
Me)]Cl2 (TAP = 1,4,5,8-tetraazaphenanthrene; dppz =
dipyrido[3,2-a:2′,3′-c]phenazine), and examine the consequences for DNA binding through the use of atomic-resolution Xray
crystallography. We find that the methyl groups are located in discrete positions with a complete directional preference. This
may help to explain the quenching behavior found in solution for analogous [Ru(phen)2(dppz)]2+ derivatives.
|
Jun 2015
|
|
I02-Macromolecular Crystallography
|
James
Hall
,
Juan
Sanchez-Weatherby
,
Cora
Alberti
,
Elena Carolina
Hurtado Quimper
,
Kyra
O'Sullivan
,
John
Brazier
,
Graeme
Winter
,
Thomas
Sorensen
,
John
Kelly
,
David
Cardin
,
Christine J.
Cardin
Abstract: Hydration-dependent DNA deformation has been known since Rosalind Franklin recognized that the relative humidity of the sample had to be maintained to observe a single conformation in DNA fiber diffraction. We now report for the first time the crystal structure, at the atomic level, of a dehydrated form of a DNA duplex and demonstrate the reversible interconversion to the hydrated form at room temperature. This system, containing d(TCGGCGCCGA) in the presence of Λ-[Ru(TAP)2(dppz)]2+ (TAP = 1,4,5,8-tetraazaphenanthrene, dppz = dipyrido[3,2-a:2′,3′-c]phenazine), undergoes a partial transition from an A/B hybrid to the A-DNA conformation, at 84–79% relative humidity. This is accompanied by an increase in kink at the central step from 22° to 51°, with a large movement of the terminal bases forming the intercalation site. This transition is reversible on rehydration. Seven data sets, collected from one crystal at room temperature, show the consequences of dehydration at near-atomic resolution. This result highlights that crystals, traditionally thought of as static systems, are still dynamic and therefore can be the subject of further experimentation.
|
Dec 2014
|
|
